View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3457_high_8 (Length: 239)
Name: NF3457_high_8
Description: NF3457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3457_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 34843925 - 34843721
Alignment:
| Q |
16 |
gaacatgcagccgttgagaattggcgactaagctaatattgatagtaaagatttggagggaaattaagatattctctttgaggtaccaaaaagcttttta |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
34843925 |
gaacatgcagccgttgagaattggtgactaagctaatattgatagtaaagatttggagggaaattaagatattatctttgaggtaccaaaa-gcttttta |
34843827 |
T |
 |
| Q |
116 |
cactccacttgcaaggtatatataaaagcgtataaaattgaattaattgaaacttaagcacaatactaatttgcttatgtttgcacatagatcatagtac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843826 |
cactccacttgcaaggtatatataaaagcgtataaaattgaattaatttaaacttgagcacaatactaatttgcttatgtttgcacatagatcatagtac |
34843727 |
T |
 |
| Q |
216 |
caaacc |
221 |
Q |
| |
|
|||||| |
|
|
| T |
34843726 |
caaacc |
34843721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University