View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3457_high_9 (Length: 213)
Name: NF3457_high_9
Description: NF3457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3457_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 7917859 - 7918043
Alignment:
| Q |
13 |
gagaggaggaaggttagtagcagtggattctggttcttgtttaggagtagaaggtgagagtttttctagttttgatgagaaaatgggagaaaaatcttta |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
7917859 |
gagaggaacaaggttagtagcagtggattctggttcttgtttaggagtagaaggtgagagttttgctagttttgatgaggaaatgggagaaaaatcttta |
7917958 |
T |
|
| Q |
113 |
gctttggactctgatgcaatgtaaacttttaggccaatctcacccttaacagatgnnnnnnnccacttattttctagtggtaaaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7917959 |
tatttggactctgatgcaatgtaaacttttaggccaatctcacccttaacagatgaaaaaaaccacttattttctagtggtaaaa |
7918043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University