View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3457_low_10 (Length: 213)

Name: NF3457_low_10
Description: NF3457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3457_low_10
NF3457_low_10
[»] chr4 (1 HSPs)
chr4 (13-197)||(7917859-7918043)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 7917859 - 7918043
Alignment:
13 gagaggaggaaggttagtagcagtggattctggttcttgtttaggagtagaaggtgagagtttttctagttttgatgagaaaatgggagaaaaatcttta 112  Q
    |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||    
7917859 gagaggaacaaggttagtagcagtggattctggttcttgtttaggagtagaaggtgagagttttgctagttttgatgaggaaatgggagaaaaatcttta 7917958  T
113 gctttggactctgatgcaatgtaaacttttaggccaatctcacccttaacagatgnnnnnnnccacttattttctagtggtaaaa 197  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||    
7917959 tatttggactctgatgcaatgtaaacttttaggccaatctcacccttaacagatgaaaaaaaccacttattttctagtggtaaaa 7918043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University