View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3458_high_8 (Length: 296)
Name: NF3458_high_8
Description: NF3458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3458_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 42 - 245
Target Start/End: Complemental strand, 27243823 - 27243619
Alignment:
| Q |
42 |
agtagcaaaggtccccatttccctctagtaataaaagatagaagtatggtgaatattgttccaaggatccaagacttcctgcaagagaatgtcttttttc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243823 |
agtagcaaaggtccccatttccctctagtaataaaggatagaagtatggtgaatattgttccaaggatccaagacttcctgcaagagaatgtcttttttc |
27243724 |
T |
 |
| Q |
142 |
aactctttgtcattgattgtt-nnnnnnnnnnnnnntaactctttaaatcttcatcaattgcaaagtcagattaaatcacaaggggcaagaaaagtcaat |
240 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27243723 |
aactctttgtcattgattgttaaaaaaaactaaaaagaactctttaaatcttcatcaattgcaaagtcagattaaatcaaaaggggcaagaaaagtcaat |
27243624 |
T |
 |
| Q |
241 |
tacat |
245 |
Q |
| |
|
||||| |
|
|
| T |
27243623 |
tacat |
27243619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University