View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3459_high_12 (Length: 225)
Name: NF3459_high_12
Description: NF3459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3459_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 31820797 - 31821009
Alignment:
| Q |
1 |
ttcaaggataaaactcatgtggtttgtgttgccgatgtgtcatacgaagataggcgctttttgtttaggttgaatgaacgccannnnnnnncttccttac |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31820797 |
ttcaaggataaaactcacgtggtttgtgttgccgatgtgtcatacgaagataggcactttttgtttaggttgaatgaacgccattttttttcttccttac |
31820896 |
T |
|
| Q |
101 |
tcctttcttcggagaacactaacgtgggctcaaacccgtaaacaaacttaaagtttgtccattgagtactagccaaaagaaaagtattttgctaaaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31820897 |
tcctttcttcggagaacactaacgtggactcaaacccgtaaacaaacctaaagtttgtccattgaatactagccaaaagaaaagtattttgctaaaatct |
31820996 |
T |
|
| Q |
201 |
cttccctctcctc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31820997 |
cttccctctcctc |
31821009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University