View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3459_low_11 (Length: 232)
Name: NF3459_low_11
Description: NF3459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3459_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 5295038 - 5295252
Alignment:
| Q |
4 |
tttctatgaatgataattaccaattagattagttaattaactggcttaatcggaaatgtaaatagtttatttattgtaattttgcaagtatttggtgttc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295038 |
tttctatgaatgataattaccaattagattagttaattaactggcttaatcagaaatgtaaatagtttatttattgtaattttgcaagtatttggtgttc |
5295137 |
T |
 |
| Q |
104 |
ttgttatgcttttatttaacttgaaactcttgagtttctatttatcaac----ttagcta-tttagtgttggtttgcatagattttgtcaaatttcatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295138 |
ttgttatgcttttatttaacttgaaactcttgagtttctatttatcaacttatttagctattttagtgttggtttgcatagattttgtcaaatttcatgt |
5295237 |
T |
 |
| Q |
199 |
ttctagcctctagtt |
213 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5295238 |
ttctagcctctagtt |
5295252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University