View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3461_low_16 (Length: 251)
Name: NF3461_low_16
Description: NF3461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3461_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 53278905 - 53279129
Alignment:
| Q |
1 |
cattaaatccaaaattatgatattatattattcttgcaaagtttgttgagaaactatttgttttcattaggtataaaattgatctgaaaaattgtacata |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53278905 |
cattaaatccaaaattatggtattatattattcttggaaagtttgttgagaaactatttgttttcattaggtataaaattgatctgaaa---------ta |
53278995 |
T |
|
| Q |
101 |
taaattagttttggttttataatggcaggttataaagtcgttgacaaaggatgttgtggcacaggagcagtagaggtagcagtgttatgcaaccaatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53278996 |
taaattagttttggttttataatggcaggttataaagtcgttgacaaaggatgttgtggcacaggagcagtagaggtagcagtgttatgcaaccaatttg |
53279095 |
T |
|
| Q |
201 |
ctacccaatgtgaagatgttagggactacgtttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
53279096 |
ctacccaatgtgaagatgttagggactacgtttt |
53279129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 11835746 - 11835687
Alignment:
| Q |
1 |
cattaaatccaaaattatgatattatattattcttgcaaagtttgttgagaaactatttg |
60 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835746 |
cattaaatccaaaattatggtattatattattcttgcaaagtttgttgagaaactatttg |
11835687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University