View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3461_low_20 (Length: 244)
Name: NF3461_low_20
Description: NF3461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3461_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 55381789 - 55382021
Alignment:
| Q |
14 |
aggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatccc--acaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55381789 |
aggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatcccccacaat |
55381888 |
T |
|
| Q |
112 |
ttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatgagct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381889 |
ttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatgagct |
55381988 |
T |
|
| Q |
212 |
atgatccctaaaaatatcaatgaggttatgacc |
244 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
55381989 |
atgatccctaaaaatatcaattaggttatgacc |
55382021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University