View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3461_low_21 (Length: 241)
Name: NF3461_low_21
Description: NF3461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3461_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 3829518 - 3829303
Alignment:
| Q |
20 |
tttagctacactaaaacattagtcctggatccgtcctaaccacacaccgtaaatccacaatcacaataacaaataaaaagtaggaattgaaaatgagaaa |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
3829518 |
tttagccacactaaaacattagtcctggatccgtcctaaccacacaccgtaaatccacaatcacaataataaataaaaagtaggaattaaaaatgagaaa |
3829419 |
T |
 |
| Q |
120 |
atcttacgacacttttaaaatatgaagtcgttacaagagcaattataatcctttgatattaacttttacaatttttggattacaaatagtatacttattg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3829418 |
atcttacgacacttttaaaatatgaagtcgttacaagagcaattataatcctttgatattaacttttacaatttttggattac-aatagtatacttattg |
3829320 |
T |
 |
| Q |
220 |
taactccaaattatcat |
236 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
3829319 |
taactccaaattttcat |
3829303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University