View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3461_low_26 (Length: 224)
Name: NF3461_low_26
Description: NF3461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3461_low_26 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 59 - 224
Target Start/End: Original strand, 39087687 - 39087851
Alignment:
| Q |
59 |
ccaataatatttgtttgctgtgatgtggatttttactgttttaacaaaattggaaaagaaaagatacttgcaaatnnnnnnngtgcatacggcaggtaaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
39087687 |
ccaataatatttgtttgctgtgatgtggatttttactgttttaacaaaattggaaaagaaaagatacttgcaaat-aaaaaagtgcatacggcaggtaca |
39087785 |
T |
 |
| Q |
159 |
ttccatcgatcggttgttaattttttgttaatcaacaacttaattttactgatatttcaacagcaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
39087786 |
ttccatcgatcggttgttaattttttgttaatcaccaacttaattttactgatatctcaacagcaa |
39087851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Original strand, 39087622 - 39087661
Alignment:
| Q |
3 |
gatgaagtgttggttcaaagtaaaaatctaatatgatagaa |
43 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39087622 |
gatgaagtgttg-ttcaaagtaaaaatctaatatgatagaa |
39087661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University