View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3461_low_26 (Length: 224)

Name: NF3461_low_26
Description: NF3461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3461_low_26
NF3461_low_26
[»] chr1 (2 HSPs)
chr1 (59-224)||(39087687-39087851)
chr1 (3-43)||(39087622-39087661)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 59 - 224
Target Start/End: Original strand, 39087687 - 39087851
Alignment:
59 ccaataatatttgtttgctgtgatgtggatttttactgttttaacaaaattggaaaagaaaagatacttgcaaatnnnnnnngtgcatacggcaggtaaa 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||| |    
39087687 ccaataatatttgtttgctgtgatgtggatttttactgttttaacaaaattggaaaagaaaagatacttgcaaat-aaaaaagtgcatacggcaggtaca 39087785  T
159 ttccatcgatcggttgttaattttttgttaatcaacaacttaattttactgatatttcaacagcaa 224  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||    
39087786 ttccatcgatcggttgttaattttttgttaatcaccaacttaattttactgatatctcaacagcaa 39087851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Original strand, 39087622 - 39087661
Alignment:
3 gatgaagtgttggttcaaagtaaaaatctaatatgatagaa 43  Q
    |||||||||||| ||||||||||||||||||||||||||||    
39087622 gatgaagtgttg-ttcaaagtaaaaatctaatatgatagaa 39087661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University