View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3462_high_12 (Length: 244)

Name: NF3462_high_12
Description: NF3462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3462_high_12
NF3462_high_12
[»] chr3 (1 HSPs)
chr3 (18-224)||(42118699-42118905)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 42118905 - 42118699
Alignment:
18 gatatggtgagattgaagagagttaaggaagagtcggtgagagattttgggatattgctcatgatagatggaaaacaaaatacataacaacnnnnnnngg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
42118905 gatatggtgagattgaagagagttaaggaagagtcggtgagagattttgggatattgctcatgatagatggaaaacaaaatacataacaacaaaaaa-gg 42118807  T
118 aatgatgaagaggatatgagaagggttgtatatataaggtggggaaagtataggttaggttagggtgtacaaatattgatgttagtgtgaaaagggtg-t 216  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
42118806 aatgatgaagaggatatgagaagggttgtatatataaggtcgggaaagtataggttaggttagggtgtacaaatattgatgttagtgggaaaagggtgtt 42118707  T
217 attgtgtt 224  Q
    ||||||||    
42118706 attgtgtt 42118699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University