View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3462_high_12 (Length: 244)
Name: NF3462_high_12
Description: NF3462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3462_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 42118905 - 42118699
Alignment:
| Q |
18 |
gatatggtgagattgaagagagttaaggaagagtcggtgagagattttgggatattgctcatgatagatggaaaacaaaatacataacaacnnnnnnngg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42118905 |
gatatggtgagattgaagagagttaaggaagagtcggtgagagattttgggatattgctcatgatagatggaaaacaaaatacataacaacaaaaaa-gg |
42118807 |
T |
 |
| Q |
118 |
aatgatgaagaggatatgagaagggttgtatatataaggtggggaaagtataggttaggttagggtgtacaaatattgatgttagtgtgaaaagggtg-t |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
42118806 |
aatgatgaagaggatatgagaagggttgtatatataaggtcgggaaagtataggttaggttagggtgtacaaatattgatgttagtgggaaaagggtgtt |
42118707 |
T |
 |
| Q |
217 |
attgtgtt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
42118706 |
attgtgtt |
42118699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University