View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3463_low_3 (Length: 202)
Name: NF3463_low_3
Description: NF3463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3463_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 18184614 - 18184785
Alignment:
| Q |
18 |
cttaagtatcttgtatagaagtgtcctggcattcagaaatcagaaccctgttcgtggactttctcaagttagtaaggataaattgccagatattaggtat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18184614 |
cttaagtatcttgtatagaagtgtcctggcattcagaaatcagaaccctgttcgtggactttctcaagttagtaaggataaattgccggatattaggtat |
18184713 |
T |
|
| Q |
118 |
gtatgaaaggtaagcactaatcatccattatattttgtcatgtgatcttgtcatgggttgtattatttctct |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18184714 |
atatgaaaggtaagcactaatcatgcattatattttgtcatgtgatcttgtcatgggttgtattatttctct |
18184785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 189
Target Start/End: Complemental strand, 35790449 - 35790385
Alignment:
| Q |
125 |
aggtaagcactaatcatccattatattttgtcatgtgatcttgtcatgggttgtattatttctct |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
35790449 |
aggtaagcactaatcaagcattatattttgtcctgcaatcttgtcatgggcaatattatttctct |
35790385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University