View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3464_high_6 (Length: 261)
Name: NF3464_high_6
Description: NF3464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3464_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 22 - 261
Target Start/End: Complemental strand, 34276055 - 34275831
Alignment:
| Q |
22 |
aagaaaatatcagtatcagtgcattcaagcacaggtacagcttcaccaaagttttcagttgaatcttcatttagctcttctgtaatcatgcgaaaagagc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34276055 |
aagaaaatatcagtatcagtgcattcaagcacaggtacagcttcaccaaagttttcagttgaatcttcatttagctcttctgtaatcatgcgaaaagagc |
34275956 |
T |
 |
| Q |
122 |
atatnnnnnnnttgtcgtcactaatgagtaagagataaattacacacaaaccagtaacataatgcagttaaatgaaacatttttcctcttcaacataatt |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34275955 |
atataaaaaaattgtcgtcactaatgagtaagagataaattacacacaaaccagtaacataatgcagttaaatg---------------tcaacataatt |
34275871 |
T |
 |
| Q |
222 |
tctaacctgaattgtcagattcttcatccgaagagccatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275870 |
tctaacctgaattgtcagattcttcatccgaagagccatc |
34275831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University