View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3464_low_11 (Length: 235)
Name: NF3464_low_11
Description: NF3464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3464_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 34275707 - 34275487
Alignment:
| Q |
1 |
aaagaggatggtgttttgtatatgttgctacatcagttgtgtcctcgattttctttcttcttcttctcactttggccttacttctgcactggtgacttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34275707 |
aaagaggatggtgttttgtatatgttgctacatcagttgtgtcctcgattttctttcttcttcttctcactttggccttacttctgtactggtgacttga |
34275608 |
T |
 |
| Q |
101 |
aaatggcaccgacctcgaaccaaattcttccaagttaaaatggtccgttgccttgtgcttttccctgtcacacttttcaagctcctttctacacttgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275607 |
aaatggcaccgacctcgaaccaaattcttctaagttaaaatggtccgttgccttgtgcttttccctgtcacacttttcaagctcctttctacacttgaat |
34275508 |
T |
 |
| Q |
201 |
tcttgagactcaagttgtttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34275507 |
tcttgagactcaagttgtttg |
34275487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 36 - 108
Target Start/End: Complemental strand, 34282884 - 34282812
Alignment:
| Q |
36 |
gttgtgtcctcgattttctttcttcttcttctcactttggccttacttctgcactggtgacttgaaaatggca |
108 |
Q |
| |
|
||||||||||| | |||||||| || |||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
34282884 |
gttgtgtcctcaactttctttcgtcgtcttctcattttcgccttacttctgtactggtgacttgaaaatggca |
34282812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University