View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3465_high_4 (Length: 232)
Name: NF3465_high_4
Description: NF3465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3465_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1252433 - 1252214
Alignment:
| Q |
1 |
tgcacaataataacttcttcttttttgacaaaaaaataataacttgtttgatgnnnnnnnnnngtcaaaaacannnnnnnaattggccatccatagttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
1252433 |
tgcacaataataacttcttcttttttgacaaaaaaataataacttgtttgatgaaaaaaaaa-gtcaaaaacatttttttaattggccatccatagttga |
1252335 |
T |
|
| Q |
101 |
cttttgaattgcaaattgagcattcaattcaatgacacactgtgatcgatgaaaccaacacaggagacaaatatttttaggatccattaaaatggattgg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252334 |
cttttgaattgtaaattgagcattcaattcaatgacacactgtgatcgatgaaaccaacacaggagacaaatatttttaggatccattaaaatggattgg |
1252235 |
T |
|
| Q |
201 |
acccttccccaagaaagtaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1252234 |
acccttccccaagaaagtaac |
1252214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University