View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3465_low_6 (Length: 232)

Name: NF3465_low_6
Description: NF3465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3465_low_6
NF3465_low_6
[»] chr5 (1 HSPs)
chr5 (1-221)||(1252214-1252433)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1252433 - 1252214
Alignment:
1 tgcacaataataacttcttcttttttgacaaaaaaataataacttgtttgatgnnnnnnnnnngtcaaaaacannnnnnnaattggccatccatagttga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||       ||||||||||||||||||||    
1252433 tgcacaataataacttcttcttttttgacaaaaaaataataacttgtttgatgaaaaaaaaa-gtcaaaaacatttttttaattggccatccatagttga 1252335  T
101 cttttgaattgcaaattgagcattcaattcaatgacacactgtgatcgatgaaaccaacacaggagacaaatatttttaggatccattaaaatggattgg 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1252334 cttttgaattgtaaattgagcattcaattcaatgacacactgtgatcgatgaaaccaacacaggagacaaatatttttaggatccattaaaatggattgg 1252235  T
201 acccttccccaagaaagtaac 221  Q
    |||||||||||||||||||||    
1252234 acccttccccaagaaagtaac 1252214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University