View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3467_high_5 (Length: 375)
Name: NF3467_high_5
Description: NF3467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3467_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 15 - 169
Target Start/End: Complemental strand, 14435200 - 14435046
Alignment:
| Q |
15 |
aaaagggtggttggaatgctgccatcttcatcatatgtaagttcaacttcaattcaacccttttcattatataattgatcatgcttcatcatatagttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435200 |
aaaagggtggttggaatgctgccatcttcatcatatgtaagttcaacttcaattcaacccttttcattatataattgatcatgcttcatcatatagttca |
14435101 |
T |
 |
| Q |
115 |
aatttcaattcaaccccctcaattattattctttcttccaaatctccaacaccca |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435100 |
aatttcaattcaaccccctcaattattattctttcttccaaatctccaacaccca |
14435046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 222 - 367
Target Start/End: Complemental strand, 14435006 - 14434861
Alignment:
| Q |
222 |
gttgtggaatttgctgagagatttgcataccaaggtttggcatcaaatctcataaactacctcacaaaatttctgaatgaaccaacaaccacagcagtga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435006 |
gttgtggaatttgctgagagatttgcataccaaggtttggcatcaaatctcataaactacctcacaaaatttctgaatgaaccaacaaccacagcagtga |
14434907 |
T |
 |
| Q |
322 |
aaaacgtgaacacatgggttggtgtctcctcactattccctttgct |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14434906 |
aaaacgtgaacacatgggttggtgtctcctcactattccctttgct |
14434861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University