View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3467_low_9 (Length: 223)
Name: NF3467_low_9
Description: NF3467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3467_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 209
Target Start/End: Original strand, 4315539 - 4315736
Alignment:
| Q |
12 |
tgatatgaatggagattggaccgaaagagataaaatcagagattgattatttgtatctggtgcagtaaggtcgagttgttactttgtgaaagtgtgtgtt |
111 |
Q |
| |
|
||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4315539 |
tgatatggatggagattggatcgaaagagatgaaatcagagattgattatttgtatctggtgcagtaaggtcaagttgttactttgtgaaagtgtgtgtt |
4315638 |
T |
 |
| Q |
112 |
gctgttgtcatgtgtgaatatggtctcagtaacgacaaggaaataggcataggatgctgaaatggatccattccccgaaaagtttcacatgaatgaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4315639 |
gctgttgtcatgtgtgaatatggtctcagtaacgacaaggaaataggcataggatgctgaaatggatccattcaccgaaaagtttcacatgaatgaat |
4315736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University