View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3468_low_12 (Length: 244)
Name: NF3468_low_12
Description: NF3468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3468_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0386 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 6068570 - 6068344
Alignment:
| Q |
19 |
tattagactaacctctatatgcacttacgtt-acctcttcaagctctatatagaacttgtttaaagaatttgtgttttcgtgcaacacatatattttatc |
117 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068570 |
tattagactaacctctatataaacttatgtttacctcttgaagctctatatagaacatgtttaaagaatttgtgttttcgtgcaacacatatattttatc |
6068471 |
T |
|
| Q |
118 |
taccaactaatattatagctagtttttagaagacatgacacgcattcgactaagattaaagaaaatatgtgttctatatattgccgaccggtagctattt |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6068470 |
taccaactaatattatagctggtttttagaagacgggacatgcattcgactaagattaaagaaaatatgtgttctatatattgccgaccagtaactattt |
6068371 |
T |
|
| Q |
218 |
gcacattcttatgattatatcacttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6068370 |
gcacattcttatgattatatcacttct |
6068344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 119 - 185
Target Start/End: Complemental strand, 15865 - 15799
Alignment:
| Q |
119 |
accaactaatattatagctagtttttagaagacatgacacgcattcgactaagattaaagaaaatat |
185 |
Q |
| |
|
||||| ||||||||||||||||||||| | || | |||| ||||||||||||||||||||||||||| |
|
|
| T |
15865 |
accaattaatattatagctagtttttaaaggagaggacatgcattcgactaagattaaagaaaatat |
15799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University