View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3468_low_13 (Length: 238)
Name: NF3468_low_13
Description: NF3468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3468_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42553391 - 42553160
Alignment:
| Q |
1 |
caggttgatgctgaggtctccttgtggaactttaccatctaatctat--------------ttcttctactttcaaattcttttttattttaattagtac |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || || |||||| |||||||||||||||||| |||| |
|
|
| T |
42553391 |
caggttgatgctgaggtctccttgtggaactttaccatctaatctatgagatgcattttgctttttgtactttgaaattcttttttatttta----gtac |
42553296 |
T |
 |
| Q |
87 |
atgtagtttgtaattcttatcacatacgattgtgaaaaacagtagtaattctcaacaatgatcatatttttaagttgttcagacttcagactatcctcac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42553295 |
atgtagtttgtaattcttatcacatacgattgtgaaaaacagtagtaattctcaacaatgatcatatttttaagctgttcagacttcagactatcctcac |
42553196 |
T |
 |
| Q |
187 |
agggaacatggcttttgattaaattcaagcagagtg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553195 |
agggaacatggcttttgattaaattcaagcagagtg |
42553160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University