View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3468_low_14 (Length: 236)
Name: NF3468_low_14
Description: NF3468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3468_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40383541 - 40383761
Alignment:
| Q |
1 |
agttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttcctccgggagtctcttcaagctcacggattagatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
40383541 |
agttacagatgctggtttatactttaactgccatgacttgttgaactctacaaggctttttgttcctccgggattttcttcaagctcacggattagatcc |
40383640 |
T |
|
| Q |
101 |
agtgcgaattctgtcttgttctcgttttctggtatgggatggccgaattcatggaaaaaactagggaggttcgccggagagccgctgtagacggtttgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383641 |
agtgcgaattctgtcttgttctcgttttctggtatgggatggccgaattcatggaaaaaactagggaggttcgccggagagccgctgtagacggtttgtc |
40383740 |
T |
|
| Q |
201 |
catgggaaaggaagatcaaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40383741 |
catgggaaaggaagatcaaac |
40383761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University