View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3468_low_8 (Length: 357)
Name: NF3468_low_8
Description: NF3468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3468_low_8 |
 | |
|
| [»] scaffold0386 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 6068316 - 6067973
Alignment:
| Q |
1 |
acttctaagacagtggtagcgagcgagagacaaaatcctcttcgaggcgtagagatcactaacatggaattttccttttccagcaagaaattttccatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6068316 |
acttctaagacagtggtagcgagcgagagacaaaatcctcttcgaggcgtagagaacactaacatggaattttcctattccaacaagaaattttccatgc |
6068217 |
T |
|
| Q |
101 |
ttaagggactcaattatatgtatttgccgcgggtcttttgactaattttgtgcatacaaatgtgttttacattagatgcctctgattactttgtatccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6068216 |
ttaagggactcaattatatgtatttgccgcgggtcttttgactaattttgtgcatacaaatgtgttttacattagatgtctctgattactttgtatccta |
6068117 |
T |
|
| Q |
201 |
gaagactaaacatttctttatcttttatacattttcttagaatgcataaggctaatccattgaagtctttttcaacaggactaaatacaagtatacttaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068116 |
gaagactaaacatttctttatcttttatgcattttcttagaatgcataaggctaatccattgaagtctttttcaacaggactaaatacaagtatacttaa |
6068017 |
T |
|
| Q |
301 |
gcttcttcaacacaaggtttaactttttgttatagtattccttc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068016 |
gcttcttcaacacaaggtttaactttttgttatagtattccttc |
6067973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 15693 - 15641
Alignment:
| Q |
30 |
acaaaatcctcttcgaggcgtagagatcactaacatggaattttccttttcca |
82 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
15693 |
acaaaatcctcctctaggcttagagatcactaacatggaatttgcctattcca |
15641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University