View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_high_48 (Length: 319)
Name: NF3470_high_48
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 129 - 279
Target Start/End: Original strand, 31119229 - 31119379
Alignment:
| Q |
129 |
gaggagattaaaatagagtgtttgttatttttataactattgtttgtagatatactcctaataattttagcgcnnnnnnnnaataaagtttattttgatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
31119229 |
gaggagattaaaatagagtgtttgttatttttataactattgtttgtagatatactcctaataattttagcgcttttttttaataaagtttattttgctt |
31119328 |
T |
 |
| Q |
229 |
gtacaaaatttacctccatatataaaaagattaggctaactccgccattgc |
279 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31119329 |
gtacaaaatttagctccatacataaaaagattaggctaactccgccattgc |
31119379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 31119101 - 31119189
Alignment:
| Q |
1 |
tcccaagccaaaacatgccctttgatttgaaaagttgtatggtctaaaacaagtgttgcaatgtttaagtatcagtaaattgagttgag |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31119101 |
tcccaagccaaaacatgccctttgatttgaaaagttgtatggtctaaaacaagtgttgcaatgtttaagtatcagtaaattgagttgag |
31119189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University