View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_high_55 (Length: 264)
Name: NF3470_high_55
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_high_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 43 - 254
Target Start/End: Complemental strand, 32950704 - 32950493
Alignment:
| Q |
43 |
cagaaagcggaaagctaaagacagaatgcagaaagctgaagaccgaaagcagaaagctaagataatgaagttcgaaagaagccagccacccaggatcgct |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950704 |
cagaaagcggaaagctaaagacagaatgcagaaagctgaagaccgaaagcagaaagctaagataatgaagttcgaaagaagccagccacccaggatcgct |
32950605 |
T |
|
| Q |
143 |
aaggcagcttaagtttaaaagcagttggaggcttaagatgaagaaaatccatgtggtttatgttttggccctttttagtcttttatttaaatattgattt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32950604 |
aaggcagcttaagtttaaaagcagttggaggcttaagatgaagaaaatccatgtggtttatgttttggccctttatagtcttttatttaaatattgattt |
32950505 |
T |
|
| Q |
243 |
aactgctctctg |
254 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32950504 |
aactgctctctg |
32950493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University