View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_high_65 (Length: 250)
Name: NF3470_high_65
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 110 - 234
Target Start/End: Complemental strand, 30691390 - 30691266
Alignment:
| Q |
110 |
atggaacaggtcagaacaggtgctcgagtttctaatgatgaaatcttaggctttgccaaattatttaatgacgagttcactttggataacattagcaggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30691390 |
atggaacaggtcagaacaggtgctcgagtttctaatgatgaaatcttaggctttgccaaattatttaatgacgagttcactttggataacattagcaggt |
30691291 |
T |
 |
| Q |
210 |
tgatccttctaccattggttatgtt |
234 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
30691290 |
tggtccttctaccattggttatgtt |
30691266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 30691499 - 30691451
Alignment:
| Q |
1 |
gcagaagatcttgatgaatttatgaacaaggtcagctacgctcttcatg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30691499 |
gcagaagatcttgatgaatttatgaacaaggtcagctacgctcttcatg |
30691451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University