View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_high_74 (Length: 239)
Name: NF3470_high_74
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_high_74 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 47307802 - 47307576
Alignment:
| Q |
14 |
cttgtaaaaacaaacccgtaacaatcttctgctaatagtggagcatgaagtattatttcatgaatcagaagattcttagttgctccttcagcatggctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47307802 |
cttgtaaaaacaaacccgtaacaatcttctgctaatagtggagcatgaagtattatttcatgaatcagaagattcttagttgctccttgagcatggctaa |
47307703 |
T |
|
| Q |
114 |
cacaatactgcagcacacaacatccggtcttatctcttgaaagtgacaaagaatttcttgcaataactcccaggaatttctgtgacagaagtccataatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47307702 |
cacaatactgcagcacacaacatccggtcttatctcttgaaagtgacaaagaatttcttgcaataactcccaggaatttctgtgacaaaagtccataatc |
47307603 |
T |
|
| Q |
214 |
ag-aacataaactgaagttaagtaatt |
239 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
47307602 |
agaaacataaactgaagttaagtaatt |
47307576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University