View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_low_68 (Length: 249)
Name: NF3470_low_68
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 37431182 - 37430945
Alignment:
| Q |
1 |
cgcgttaatgcgataaaaaatcagtaagacggacacgaatgcacgtctttttactagnnnnnnnnnnnnnnnnnnnnnnacgaggaacacgagcatccac |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37431182 |
cgcgttaatgcgataaaaaaacagtaagacggacacgaatgcacgtctttttactagtaataatataatataataataaacgaggaacacgagcatccac |
37431083 |
T |
 |
| Q |
101 |
ttatctatctgttattattattaagagt----aataatacgtgccttctttctgcatttgtaatagctttaattgtgaagttcctgtccataatatttga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37431082 |
ttatctatctgttattattattaagagttaataataatacgtgccttctttctgcatttgtaatagctttaattgtgaagttcctgtccataatatttga |
37430983 |
T |
 |
| Q |
197 |
tgtttgtacgtgttcccttggaatgctatcaagaaggcatct |
238 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
37430982 |
tgttt----gtgttcccttggaatgctatcaggaaggcatct |
37430945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University