View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_low_84 (Length: 224)
Name: NF3470_low_84
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 14507047 - 14506930
Alignment:
| Q |
1 |
tttgagtccgccactccattcttgttcaacaacttgatattattcgacacacgcgtggctccaaagaaattccgattgtgaactgcacaagcaagggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14507047 |
tttgagtccgccactccattcttgatcaacaacttgatattatttgacacacgcgtggctccaaagaaattccgattgtgaactgcacaagcaagggtgt |
14506948 |
T |
|
| Q |
101 |
cgtggtgagatttcaaga |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14506947 |
cgtggtgagatttcaaga |
14506930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 221
Target Start/End: Complemental strand, 14494836 - 14494723
Alignment:
| Q |
108 |
agatttcaagaatgtatacgccaattcataggtcggtatcattagattgttgaggcttgcagaaagtactgtagggttcttactgacaaggttaataata |
207 |
Q |
| |
|
||||| ||||||| | ||| ||||||||||||| || | ||| |||| ||||||||| |||| | ||| |||||||||||| |||||||||| ||| |
|
|
| T |
14494836 |
agattgcaagaatctgtacaccaattcataggttgggactatttgattcttgaggcttacagacaagactctagggttcttacaaacaaggttaacaatg |
14494737 |
T |
|
| Q |
208 |
tcagaggaagaagc |
221 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
14494736 |
tcagaggtagaagc |
14494723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University