View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3470_low_88 (Length: 209)
Name: NF3470_low_88
Description: NF3470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3470_low_88 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 12881056 - 12880885
Alignment:
| Q |
17 |
gacaaatcacccaatgagcagtttttggttcttttgccggttggttagatgggagactgaatagctatggtcttagggcctgcatcagccgtgaactgct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12881056 |
gacaaatcacccaatgagcagtttttggttcttttgccggttggttggatgggagactgaatagctatggtcttag-------atcagccgtgaactgct |
12880964 |
T |
 |
| Q |
117 |
cagaagaatcaccagcattaaaagtcttttgattgatagtttcaaaaggtacagccaatggagttccgcattgatttct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12880963 |
cagaagaatcaccagcattaaaagtcttttgattgatagcttcaaaaggtacagccaatggagttccgtattgatttct |
12880885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 41 - 136
Target Start/End: Complemental strand, 6349226 - 6349131
Alignment:
| Q |
41 |
ttggttcttttgccggttggttagatgggagactgaatagctatggtcttagggcctgcatcagccgtgaactgctcagaagaatcaccagcatta |
136 |
Q |
| |
|
||||||||||| || |||||| || |||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
6349226 |
ttggttctttttccagttggtatgaagggagactgaatagctgtggtcttagggactgcatcatccgtgaactgctcaggagaatcaccaccatta |
6349131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 6359288 - 6359231
Alignment:
| Q |
126 |
caccagcattaaaagtcttttgattgatagtttcaaaaggtacagccaatggagttcc |
183 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| ||||||||| ||||| ||||| |
|
|
| T |
6359288 |
caccagcattaaaagtcttttcattggtagtttcaacaggtacagctaatggtgttcc |
6359231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 128 - 182
Target Start/End: Complemental strand, 6372728 - 6372674
Alignment:
| Q |
128 |
ccagcattaaaagtcttttgattgatagtttcaaaaggtacagccaatggagttc |
182 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
6372728 |
ccagcattaaaagtctttccgttggtagtttcaaaaggtacagcaaatggtgttc |
6372674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University