View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_13 (Length: 418)
Name: NF3471_high_13
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 40 - 406
Target Start/End: Original strand, 40834886 - 40835249
Alignment:
| Q |
40 |
ttccttatacaacttctctgttcatctctaannnnnnnagtctcatctaaccaaannnnnnnaccacttccaatcctccctctcccaacagcattccagc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834886 |
ttccttatacaacttctctgttcatctctaacccc---agtctcatctaaccaaacccccccaccacttccaatcctccctctcccaacagcattccagc |
40834982 |
T |
 |
| Q |
140 |
tccaatggcaaaattccaacatggcccttttcttccacttcggcacaaacaccttcactgactccgaatggggtacaggtcaagctcatccaacaatctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834983 |
tccaatggcaaaattccaacatggcccttttcttccacttcggcacaaacaccttcactgactccgaatggggtacaggtcaagctcatccaacaatctt |
40835082 |
T |
 |
| Q |
240 |
caacccaacaaaactcaacgcttctcaatggattcacgttgctaaagattctggtttttcaagggttttgttaactgctaagcatcatgatgggttttgt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40835083 |
caacccaacaaaactcaacgcttctcaatggattcacgttgctaaagacactggtttttcaagggttttgttaactgctaagcatcatgatgggttttgt |
40835182 |
T |
 |
| Q |
340 |
ttgtggccttctgagtatactgattactcggtgcggtcgagtgattggagaaatgggaatggtgatg |
406 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40835183 |
ttgtggccttctgagtatactgattattcggttcggtccagtggttggagaaatgggaatggtgatg |
40835249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University