View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_35 (Length: 279)
Name: NF3471_high_35
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 271
Target Start/End: Original strand, 2486571 - 2486822
Alignment:
| Q |
20 |
ataagatctttctcattgtatttatcatgacagtgagcagacacgcgtgttgcttacaagtgctgcttatgtccatttaaagcatgcagaggtttctaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486571 |
ataagatctttctcattgtatttatcatgacagtgagcagacacgcgtgttgcttacaagtgctgcttatgtccatttaaagcatgcagaggtttctaaa |
2486670 |
T |
 |
| Q |
120 |
tatacacggaatcttgctcctgcaagccggactattctgctctcgggaccagccggttagtctgaatttggtagtttataatcagggattgataagcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2486671 |
tatacacggaatcttgctcctgcaagccggactattctgctctcgggaccagccggttagtctgaatttggtagtttataatgagggattgataagcttt |
2486770 |
T |
 |
| Q |
220 |
tatgtttctactgattccttgaagctaattcaaaacttcccctgttcatatc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486771 |
tatgtttctactgattccttgaagctaattcaaaacttcccctgttcatatc |
2486822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 49 - 180
Target Start/End: Complemental strand, 41594955 - 41594824
Alignment:
| Q |
49 |
acagtgagcagacacgcgtgttgcttacaagtgctgcttatgtccatttaaagcatgcagaggtttctaaatatacacggaatcttgctcctgcaagccg |
148 |
Q |
| |
|
||||||||||||| || || ||||||||||||||||| ||||| |||||||||||||| || |||||||||||||| || |||||||||||||| ||| | |
|
|
| T |
41594955 |
acagtgagcagacgcgggttttgcttacaagtgctgcatatgttcatttaaagcatgctgaagtttctaaatatacgcgtaatcttgctcctgctagcag |
41594856 |
T |
 |
| Q |
149 |
gactattctgctctcgggaccagccggttagt |
180 |
Q |
| |
|
|||||||| ||||| || || || ||||||| |
|
|
| T |
41594855 |
aactattcttctctctggccctgctggttagt |
41594824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University