View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_42 (Length: 260)
Name: NF3471_high_42
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 27842024 - 27842263
Alignment:
| Q |
2 |
tctctttagcaggtaacaattcaaacacttgctccctttccatgacggactttatccttcttaagaagtttgatatcacctttcatcctccaaaagatcc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27842024 |
tctctttagcaggtaacaattcaaacacttgctccctttccatgacggactttatccttcttaagaagtttgatatcacctttcatcctccaaaagctcc |
27842123 |
T |
 |
| Q |
102 |
aaagatcttagaggtgatatggcaccctcttgttgacccttggatcaaatgcaatacggatggatgctctaactctacctcttcctcctttgggggctta |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
27842124 |
aaagatcatagaggtgatatggcaccctcttgttgacccttggatcaaatgcaatacggatggatg--ctaactccacctcttcctcctgtgggggctta |
27842221 |
T |
 |
| Q |
202 |
tttcgaaatgcttctgctgacttattgctttgttttgctgag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27842222 |
tttcgaaatgcttctgctgacttattgctttgttttgctgag |
27842263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University