View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_45 (Length: 256)
Name: NF3471_high_45
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 39824738 - 39824510
Alignment:
| Q |
18 |
gttcattgcgcaaacgcaatcgaaacaaacgatgtaacacttgctcaacaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824738 |
gttcattgcgcaaacgcaatcgaaacaaacgatgtaacacttgctcagcaaatcctttgggttctcaataacatagcaccacaagacggtgattcaaatc |
39824639 |
T |
 |
| Q |
118 |
aacgcttagcttatagtttccttagagccctcacaaatcgtgcagtgaaaaccggtacctgtaaaatgctagtagaacaagtttattcaaatgctcataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824638 |
aacgcttagcttatagtttccttagagccctcacaaatcgtgcagtgaaaaccggtacctgtaaaatgctagtagaacaagtttattcaaatgctcataa |
39824539 |
T |
 |
| Q |
218 |
caatctcaccatagatacacacaggttct |
246 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
39824538 |
caatctcaccatagatacacacagattct |
39824510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University