View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_70 (Length: 232)
Name: NF3471_high_70
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 15784415 - 15784203
Alignment:
| Q |
1 |
ataaaattgatgataaagtaagaatgcatcataatcataccccaaagacacctagaaacttgacattagaaactgctgtgtatggtggaacatcgacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
15784415 |
ataaaattgatgataaagtaagaatgcatcataatcataccccaaatacacttagaaacttgacattagaaactgctttgtatgg---aacatcgacaac |
15784319 |
T |
 |
| Q |
101 |
ggcactgatcaagttggataacggtttaaagtacccttccgctgtaacaccggcatttgcttcaaaagttgtaacagcaggctctactaaaagtgtacct |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15784318 |
ggcactgatcaagttggataacgggttaaagtacccttccgctgtaataccggcatttgcttcaaaagttgtaacagcaggctctacaaaaagtgtactc |
15784219 |
T |
 |
| Q |
201 |
aaacaatccaatttgg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15784218 |
aaacaatccaatttgg |
15784203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 165
Target Start/End: Original strand, 19970058 - 19970117
Alignment:
| Q |
106 |
tgatcaagttggataacggtttaaagtacccttccgctgtaacaccggcatttgcttcaa |
165 |
Q |
| |
|
||||||| |||||||| |||||||| |||||| ||||||||||| |||||||||| |||| |
|
|
| T |
19970058 |
tgatcaatttggataagggtttaaaataccctcccgctgtaacatcggcatttgcatcaa |
19970117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 174
Target Start/End: Complemental strand, 20111471 - 20111403
Alignment:
| Q |
106 |
tgatcaagttggataacggtttaaagtacccttccgctgtaacaccggcatttgcttcaaaagttgtaa |
174 |
Q |
| |
|
||||||||||||| || ||||||||||||||| |||||||||||||||| ||||||| | |||||| |
|
|
| T |
20111471 |
tgatcaagttggacaagggtttaaagtaccctctttctgtaacaccggcattagcttcaacaattgtaa |
20111403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University