View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3471_high_74 (Length: 217)

Name: NF3471_high_74
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3471_high_74
NF3471_high_74
[»] chr1 (2 HSPs)
chr1 (6-200)||(1178459-1178653)
chr1 (27-139)||(6840305-6840417)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 1178459 - 1178653
Alignment:
6 cagaacctgtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg 105  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1178459 cagaaccggtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg 1178558  T
106 ttggaaagctgctggcttcatatgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttct 200  Q
    |||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||    
1178559 ttggaaagttgctggcatcatatgacgatcaaggcaactcgctcagcgattttcaaatttatgttttgaattactatagatgtttatggggttct 1178653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 139
Target Start/End: Complemental strand, 6840417 - 6840305
Alignment:
27 tacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagctgctggcttcat 126  Q
    ||||||||||| || |||  |||||| ||||||| | ||| ||| |||||||||||||||| ||| |||||||||||||||||| |||||||| |||| |    
6840417 tacaacattggaccggttgagtggacttgttgcagacgtggtttttggaaggatggcgatcgagtttttggaggaaaggttggacagctgctgacttcgt 6840318  T
127 atgacgatcaagg 139  Q
    |||| ||||||||    
6840317 atgaagatcaagg 6840305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University