View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_74 (Length: 217)
Name: NF3471_high_74
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 6 - 200
Target Start/End: Original strand, 1178459 - 1178653
Alignment:
| Q |
6 |
cagaacctgtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178459 |
cagaaccggtggaccaaaatttacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaagg |
1178558 |
T |
|
| Q |
106 |
ttggaaagctgctggcttcatatgacgatcaaggcaactcgctaagcgattttcaaatttatgtttcgatttactatagatgtttatggggttct |
200 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
1178559 |
ttggaaagttgctggcatcatatgacgatcaaggcaactcgctcagcgattttcaaatttatgttttgaattactatagatgtttatggggttct |
1178653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 139
Target Start/End: Complemental strand, 6840417 - 6840305
Alignment:
| Q |
27 |
tacaacattgggccagttccgtggacatgttgcataagtgatttctggaaggatggcgatcaagtctttggaggaaaggttggaaagctgctggcttcat |
126 |
Q |
| |
|
||||||||||| || ||| |||||| ||||||| | ||| ||| |||||||||||||||| ||| |||||||||||||||||| |||||||| |||| | |
|
|
| T |
6840417 |
tacaacattggaccggttgagtggacttgttgcagacgtggtttttggaaggatggcgatcgagtttttggaggaaaggttggacagctgctgacttcgt |
6840318 |
T |
|
| Q |
127 |
atgacgatcaagg |
139 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
6840317 |
atgaagatcaagg |
6840305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University