View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_high_77 (Length: 206)
Name: NF3471_high_77
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_high_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 12 - 145
Target Start/End: Original strand, 30345011 - 30345144
Alignment:
| Q |
12 |
agaacaaacacaatttctttgactcaagcactagttgtttgcatcaaatgcatatgaaaggtccaaaataattaaaatgaatgtcaacggtaaataacaa |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30345011 |
agaacaaacacaatttccttgactcaagcacgagttgtttgcatcaaatgcatatgaaaggtccaaaataattaaaatgaatgtcaacggtaaataacaa |
30345110 |
T |
 |
| Q |
112 |
ccttgctaggacaggttgaagtattaaatttcga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30345111 |
ccttgctaggacaggttgaagtattaaatttcga |
30345144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University