View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_2 (Length: 572)
Name: NF3471_low_2
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_2 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 177; Significance: 4e-95; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 260 - 444
Target Start/End: Original strand, 28634 - 28818
Alignment:
| Q |
260 |
tcttctcttctaacagaagcaactctgtagggaggagagcctgccgatcgagcgaaaggatccatacggctttcagggggagctgcttttacagcctact |
359 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28634 |
tcttctcttcgaacagaagcaactctgtagggaggagagcctgccgatcgagcgaagggatccatacggctttcagggggagctgcttttacagcctact |
28733 |
T |
 |
| Q |
360 |
ggtatttaagtaacggacgtgtttaattaattttcatgatgattcattcaattcgttcgccgggaagtgcaagctttgcgaacca |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28734 |
ggtatttaagtaacggacgtgtttaattaattttcatgatgattcattcaattcgttcgccgggaagtgcaagctttgcgaacca |
28818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 130; Significance: 4e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 64 - 260
Target Start/End: Original strand, 6101423 - 6101620
Alignment:
| Q |
64 |
ttccccaaccaattcggtcgataaaatgagaggtatatcttccttatgtcgtttcatttgtttgacaatt-acttatgtcataactgtcatcgaggtatt |
162 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
6101423 |
ttccctaaccaattcggtcgataaagtgagagttatatcttccttatgtcatttcatttgtttgacaattcacttatgtcataactgtcattgaggtatt |
6101522 |
T |
 |
| Q |
163 |
cagaccatccgcggtctctctcaattcttgtagttcttctagccaatcatgaacttttggtttgcgcttttttcgcagcaactgttttataatataat |
260 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
6101523 |
cagaccatatgtggtttctctcaattcttgtagttcttctagctaatcataaacttttggtttgcgcttttttccctgcagttgttttataatataat |
6101620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 460 - 521
Target Start/End: Original strand, 6101646 - 6101707
Alignment:
| Q |
460 |
cacttcttttaagcgtttaatctcactttcagaatcatatacattcaaattgtttggattct |
521 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
6101646 |
cacttcttttaagcgtttaatctcactttcagaatcacttacattcaaattgcttggattct |
6101707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University