View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_34 (Length: 289)
Name: NF3471_low_34
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 39165957 - 39165678
Alignment:
| Q |
1 |
ttccgcagttttgatcgtctctggaccnnnnnnnnactgggtttgcaggtatttgtgtnnnnnnnnnnnn-gacatgctttaagtcaatattccccctta |
99 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
39165957 |
ttccgcagttttgatcgtctctggaccttttttttactgggtttgcaggtatttgtgtaaaaaaaaagaaagacatgctttaactcaatattccccctta |
39165858 |
T |
 |
| Q |
100 |
ttgtgtttatgacaagtcttgggaattctcattacaggtgatgttcattattgcatgggatggaatttcaattatggatatctttcagaaggatgcttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39165857 |
ttgtgtttatgacaagtcttgggaattctcattacaggtgatgttcattattgcatgggatggaatttcaattatggatatctttcagaaggatgtttta |
39165758 |
T |
 |
| Q |
200 |
tataaactgtctagtatattcatcacagcatccattttgcgcttacttcaaagtatgaaacattcactaaagtgcctttg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39165757 |
tataaactgtctagtatattcatcacagcatccattctgcgcttacttcaaagtatgaaacattcactaaagtgcctttg |
39165678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 131 - 257
Target Start/End: Complemental strand, 43963311 - 43963185
Alignment:
| Q |
131 |
ttacaggtgatgttcattattgcatgggatggaatttcaattatggatatctttcagaaggatgctttatataaactgtctagtatattcatcacagcat |
230 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||| | |||| || ||||| || |||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43963311 |
ttacaggcgatgttcataattgcatggggaaatatttcagtgttggaaatatttcaaaaagatgtcttatataaactttctagcatattcatcacagcag |
43963212 |
T |
 |
| Q |
231 |
ccattttgcgcttacttcaaagtatga |
257 |
Q |
| |
|
|| || | || |||||||||||||||| |
|
|
| T |
43963211 |
cctttcttcgtttacttcaaagtatga |
43963185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University