View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_38 (Length: 272)
Name: NF3471_low_38
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 120 - 254
Target Start/End: Complemental strand, 44950284 - 44950150
Alignment:
| Q |
120 |
atgtgtcaaataatttactagctagtgtgctcatttttatttttcccgttcttaattcgttcatttaagctttatccatccatttgaacaagtgagaaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44950284 |
atgtgtcaaataatttactagctagtgtgctcatttttgtttttcccgttcttaatttgttcatttaagctttatccatccatttgaacaagtgagaaac |
44950185 |
T |
|
| Q |
220 |
ttaacactctagtttatttgcgagaatcatcagat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44950184 |
ttaacactctagtttatttgcgagaatcatcagat |
44950150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 44950436 - 44950317
Alignment:
| Q |
1 |
taaggcaagagcccttgaactttcttcttattatcttttcattggtagnnnnnnnnnnnnnnnnnnnnnttagtatttgaaattcttcgtagtactgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44950436 |
taaggcaagagcccttgaactttcttcttattatcttttcattggtagatatatacttatattatatatttagtatttgaaattcttcgtagtactgtac |
44950337 |
T |
|
| Q |
101 |
gtttttatctaaacttcgta |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44950336 |
gtttttatctaaacttcgta |
44950317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 250
Target Start/End: Original strand, 44730072 - 44730117
Alignment:
| Q |
205 |
gaacaagtgagaaacttaacactctagtttatttgcgagaatcatc |
250 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
44730072 |
gaacaagtgagaaatctgacactctagtttatttgcgagaatcatc |
44730117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University