View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_46 (Length: 257)
Name: NF3471_low_46
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 35905247 - 35905010
Alignment:
| Q |
10 |
caatgagaataacaactaactagtgtaattaactaattttatatctgataccaggttcatacacaaacaccacatcaagttggttgcctctctatggaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35905247 |
caatgagaataacaactaactagtgtaattaactaattttatatctgataccaggttcatacacaaacaccacatcaagttggttgcctctctatggaaa |
35905148 |
T |
 |
| Q |
110 |
ttctcacacaaccggaacgaaatcaacaggatcagggaagagtactatgggcagtggtgcaaatttagccatggctcaaggactgtgtcgatatttctct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35905147 |
ttctcacacaaccggaacgaaatcaacaggatcagggaagagtactatgggcagtggtgcaaatttagccatggctcaaggactgtgtcgatatttctct |
35905048 |
T |
 |
| Q |
210 |
ttacaagagatgaagcaagcaaccaagaattttgatga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35905047 |
ttacaagagatgaagcaagcaaccaagaattttgatga |
35905010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 247
Target Start/End: Original strand, 47624163 - 47624233
Alignment:
| Q |
177 |
gccatggctcaaggactgtgtcgatatttctctttacaagagatgaagcaagcaaccaagaattttgatga |
247 |
Q |
| |
|
|||||| | ||||| || ||||| ||||| || ||||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
47624163 |
gccatgacccaaggtctatgtcgctatttttcgttacaagagataaagcaagcaaccaacagttttgatga |
47624233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University