View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_5 (Length: 498)
Name: NF3471_low_5
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 334; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 44615992 - 44615643
Alignment:
| Q |
1 |
atggttatttgtggtgaggtgacaaatttgactctcgcgcgttgacgttgatagatacatagatagaaccctaatactctaatctcatccgtctcaaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44615992 |
atggttatttgtggtgaggtgacaaatttgactctcgtgcgttgacgttgatagatacatagatagaaccctaatactctaatctcattcgtctcaaatc |
44615893 |
T |
|
| Q |
101 |
gatccatcatcgaaacggagactctgtctctcaatctctttcccagtttcaggccatgcgaccttgttcctccgccatagccctctccagagaggactct |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615892 |
gatccatcatcgaaacagagactctgtctctcaatctctttcccagtttcaggccatgcgaccttgttcctccgccatagccctctccagagaggactct |
44615793 |
T |
|
| Q |
201 |
tttttcactttcatctctctttctatcgatttcacctcccatgtcttcctccgatgcccataccgcacccactaatatcaaccccaaatgtatcctcttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615792 |
tttttcactttcatctctctttctatcgatttcaccacccatgtcttcctccgatgcccataccgcacccactaatatcaaccccaaatgtatcctcttc |
44615693 |
T |
|
| Q |
301 |
aatgctgcatccggtgcttccgctggtataccttcttttctcagctgccc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615692 |
aatgctgcatccggtgcttccgctggtataccttcttttctcagctgccc |
44615643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 412 - 481
Target Start/End: Complemental strand, 44615560 - 44615491
Alignment:
| Q |
412 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtg |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44615560 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtg |
44615491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 412 - 473
Target Start/End: Original strand, 39314798 - 39314859
Alignment:
| Q |
412 |
gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttca |
473 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
39314798 |
gatgcaggagttattgctgctacgtttgtgtgtcctttagatgtgattaaaaccaggtttca |
39314859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University