View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_53 (Length: 250)
Name: NF3471_low_53
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 40383585 - 40383365
Alignment:
| Q |
19 |
ttcaacaagtcagggcatttaaagtataaaccagcatctgaaactgccgttaacggacctaaaatgtcgttaaaagacgccatcagtgccagtatctcaa |
118 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40383585 |
ttcaacaagtcatggcagttaaagtataaaccagcatctgtaactgccgttaacggacctaaaatgtcgttaaaagacgccatcagtgcgagtatctcaa |
40383486 |
T |
|
| Q |
119 |
gagggaaattagtctcaggaactaatggtggtaatggaaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggc |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383485 |
gagggaaattagtctcaggaactaacggtggtaatggcaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggc |
40383386 |
T |
|
| Q |
219 |
agttattggaaaacggtctct |
239 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40383385 |
ggttattggaaaacggtctct |
40383365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University