View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3471_low_53 (Length: 250)

Name: NF3471_low_53
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3471_low_53
NF3471_low_53
[»] chr7 (1 HSPs)
chr7 (19-239)||(40383365-40383585)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 40383585 - 40383365
Alignment:
19 ttcaacaagtcagggcatttaaagtataaaccagcatctgaaactgccgttaacggacctaaaatgtcgttaaaagacgccatcagtgccagtatctcaa 118  Q
    |||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
40383585 ttcaacaagtcatggcagttaaagtataaaccagcatctgtaactgccgttaacggacctaaaatgtcgttaaaagacgccatcagtgcgagtatctcaa 40383486  T
119 gagggaaattagtctcaggaactaatggtggtaatggaaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggc 218  Q
    ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40383485 gagggaaattagtctcaggaactaacggtggtaatggcaacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggc 40383386  T
219 agttattggaaaacggtctct 239  Q
     ||||||||||||||||||||    
40383385 ggttattggaaaacggtctct 40383365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University