View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_65 (Length: 238)
Name: NF3471_low_65
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_65 |
 |  |
|
| [»] scaffold0657 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0657 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0657
Description:
Target: scaffold0657; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 6591 - 6375
Alignment:
| Q |
19 |
tttctgatttaagtaaaatttcctacggaattgtttaggaggaaataaataatttattgatttcgtgtaaatgtannnnnnnnattgatatcgttttgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6591 |
tttctgatttaagtaaaatttcctacggaattgtttaggatgaaataaataatttattgatttcgtgtaaatgtatttttttgattgatatcgttttgat |
6492 |
T |
 |
| Q |
119 |
tgtggtttaagagaaagagctgaaaaaattgaaaagtggtatgattatgcatcttgtgtgtaatacaactttttgctaagttggttgattcttttattgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6491 |
tgtggtttaagagaaagagctgaaaaa-ttgaaaagtggtatgattgtgtatcttgtgtgtaatacaactttttgctaagttggttgattcttttattgt |
6393 |
T |
 |
| Q |
219 |
tagtggctggtggcttaa |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6392 |
tagtggctggtggcttaa |
6375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University