View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3471_low_71 (Length: 233)

Name: NF3471_low_71
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3471_low_71
NF3471_low_71
[»] chr2 (1 HSPs)
chr2 (136-214)||(162602-162680)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 136 - 214
Target Start/End: Complemental strand, 162680 - 162602
Alignment:
136 aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
162680 aggagaaggaggggattggggttcttcttttgtatgataatttcatttcctagccaaataatctccggacgaccatcgt 162602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University