View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_76 (Length: 219)
Name: NF3471_low_76
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 38136186 - 38136401
Alignment:
| Q |
1 |
atttgatcgatcaaactacctaaaataacaacttcaatttaaagtgtagatgacctattgaaattgtttctcttcacacctaaacgatgatgtatcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136186 |
atttgatcgatcaaactacctaaaataacaacttcaatttaaagtgtagatgacctattgaaattgtttctcttcacacctaaacgatgatgtatcaaaa |
38136285 |
T |
 |
| Q |
101 |
tatcgatagtggatgcatatggacaaagccatcaatatctcctctttggggcttatagnnnnnnnaatgccaaataaacagcatactaatgaaaagagag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38136286 |
tatcgatagtggatgcatatggacaaagctatcaatatctcctctttggggcttatagtttttttaatgccaaataaacagcatactaatgaaaagagag |
38136385 |
T |
 |
| Q |
201 |
tctaaaggatattctt |
216 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
38136386 |
tctaaaggataatctt |
38136401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University