View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3471_low_84 (Length: 205)
Name: NF3471_low_84
Description: NF3471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3471_low_84 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 47599204 - 47599032
Alignment:
| Q |
22 |
actttttcatcctccagcttttatttttgttatcgatgtttccacttctcaagatgagctttgttcacttaagaatgagattttgcttcttcttcatcat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599204 |
actttttcatcctccagcttttatttttgttatcgatgtttccacttctcaagatgagctttgttcacttaagaatgagattttgcttcttcttcatcat |
47599105 |
T |
|
| Q |
122 |
ttgcctgatactgctcttgttgctttgattacttttgattcaatggtttatcttcatgatattcagttttctc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47599104 |
ttgcctgatactgctcttgttgctttgattacttttgattcaatggtttatcttcatgatattcagttttctc |
47599032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University