View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_high_21 (Length: 332)
Name: NF3472_high_21
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 197 - 314
Target Start/End: Original strand, 42038009 - 42038126
Alignment:
| Q |
197 |
tcccaaaaacctgagaataacctccaaaaccagactactcgtcggaagttgcccattccctaggggaacagggagagggaccaaacctaatgggctgtcg |
296 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038009 |
tcccaaaaacctgagaataacctacaaaaccagactacccgtcggaagttgcccattccctaggggaacagggagagggaccaaacctaatgggctgtcg |
42038108 |
T |
 |
| Q |
297 |
agaattggaagacaaacc |
314 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
42038109 |
aggattggaagacaaacc |
42038126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 42037813 - 42037940
Alignment:
| Q |
1 |
ttaaggtgcatcatgttcatactttactannnnnnnatggcaaagataaatatattaacaaaataaagaggttgtgcaagagtgctacaaaacaaacaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037813 |
ttaaggtgcatcatgttcatactttactatttttttatggcaaagataaatatattaacaaaataaagaggttgtgcaagagtgctacaaaacaaacaga |
42037912 |
T |
 |
| Q |
101 |
aaatagcagcctgagccccaggggtacc |
128 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
42037913 |
aagtagcagcctgagccccaggggtacc |
42037940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University