View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_28 (Length: 299)
Name: NF3472_low_28
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 39917934 - 39917790
Alignment:
| Q |
1 |
ttcaacattgaactctacccttagaaatgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccaaatttatagcccaaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39917934 |
ttcaacattgaactctacccttagaaatgaacacgcagcaaattaaaatagagatagaacagtgatacaaaaacagtacccagatttatagcccaaaata |
39917835 |
T |
|
| Q |
101 |
ttgggtaagacctctattcaacagtcaaccaccatagcaattagc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917834 |
ttgggtaagacctctattcaacagtcaaccaccatagcaattagc |
39917790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 200 - 299
Target Start/End: Complemental strand, 39917737 - 39917638
Alignment:
| Q |
200 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagttacagttacaacaacgttaaccactcagctatgctgtgatt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39917737 |
gtttcgaaattcgatactacaactaaactgtcctttgtcgttgacgttgttaactaagtaacagttacaacaacgttaacaactcagctatgctgtgatt |
39917638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University