View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_32 (Length: 256)
Name: NF3472_low_32
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_32 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 184 - 256
Target Start/End: Complemental strand, 27244046 - 27243974
Alignment:
| Q |
184 |
tcataaacactaagcagatgaattaaccaatgattcaaatcagtggaagtctttagattgatttttcaaccat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27244046 |
tcataaacactaagcagatgaattaaccaatgattcaaatcagtggaagtccttagactgatttttcaaccat |
27243974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 23 - 88
Target Start/End: Complemental strand, 27244209 - 27244144
Alignment:
| Q |
23 |
ctatagtaacaatacatttgtttgctatctttcacgaaattattttcgttaaatacaacattttcg |
88 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27244209 |
ctatagtaacaatacatttgttcgctatctttcacgaaattattttcgttatatacaacattttcg |
27244144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University