View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_33 (Length: 255)
Name: NF3472_low_33
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 255
Target Start/End: Complemental strand, 53681573 - 53681333
Alignment:
| Q |
11 |
cacagactaacttgtgaagctgatcaaattgcaacaaggatcgatgagtacacaaaatttgagtcaagtgtttttgtgctgctagtatttaattatcaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53681573 |
cacagactaacttgtgaagctgatcaaattgcaacaaggat----gagtacacaaaatttgagtcaagtgtttttgtgctgctagtatttaattatcaga |
53681478 |
T |
 |
| Q |
111 |
tagaagggatttgtttttgcagtcatcaactattatagaaatgaatatggttccatcaatactttgatgatgattccgcatccctcttatggttagtact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53681477 |
tagaagggatttgtttttgcagtcatcaactattatagaaatgaatatggttccatcaatactttgatgatgattccgcatccctcttatggttagtact |
53681378 |
T |
 |
| Q |
211 |
agtactatttgaaaatttcattagatttatgtcaccatttccttt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53681377 |
agtactatttgaaaatttcattagatttatgtcaccattttcttt |
53681333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University